Task summary
Task ID1413424027
Sequence Name
Predicted poly(A) site    Real poly(A) site
Pattern Viewer (Click to Hide or Show)
Typical Pattern      (AATAAA       TGTAA      )
 Change All AATAAA TATAAA CATAAA GATAAA ATTAAA ACTAAA
 AGTAAA AAAAAA AACAAA AAGAAA AATTAA AATCAA AATGAA
 AATATA AATACA AATAGA AATAAT AATAAC AATAAG
User’s Pattern         (Ex. AATAAA, TGTAA) Predicted poly(A) site    N      Real poly(A) site    N      Predicted&Real poly(A) site    N

TGTACTAGTAAGTACGGTCGTCGGAGACCGTTTATTGTCGCCGGAGCTGTGGCGATTTCTATCTCTGTTATGGTTATTGGTCATGCGGCGGATATTGGATGGGCATTTGGGGATAGAGAAGGGAAGATTAAGCCGAGGGCGATTGTTGCTTTTGTTTTAGGGTTTTGGATTCTTGATGTTGCTAATAATATGACTCAAGGTCCTTGTAGAGCTCTCCTTGCTGATCTTACTGGTAAAGTTCCTGACTTTAGTGTTGATTGGGTCTTCAATTTGAAATCATTCAAATGTAGTAAATTTGGGATTCTCGTGATTATACACTCACATGCAAAACATGAAAATGCATAAATTTGTGATTTTGGATACAATTTGGGGTTATATAATTACCTAATTGGTTCCTAAC

Result files
Poly(A) score file
Poly(A) sites predicted
Poly(A) plots
© Copyright BMI Lab 2005-2013